If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo, JapanThe Department of Respiratory Medicine, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo, JapanDepartment of Thoracic Medical Oncology, The Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo, Japan
Corresponding author. Address for correspondence: Ryohei Katayama, PhD, Division of Experimental Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, 3-8-31, Ariake, Koto-ku, Tokyo 135-8550, Japan.
The survival of patients with EGFR mutation-positive lung cancer has dramatically improved since the introduction of EGFR tyrosine kinase inhibitors (EGFR-TKIs). Recently, osimertinib showed significantly prolonged progression-free survival than first-generation EGFR-TKI in first-line treatment, suggesting that a paradigm change that would move osimetinib to first-line treatment is indicated. We performed N-ethyl-N-nitrosourea (ENU) mutagenesis screening to uncover the resistant mechanism in first- and second-line osimertinib treatment.
Methods
Ba/F3 cells harboring EGFR activating-mutation with or without secondary resistant mutation were exposed to ENU for 24 hours to introduce random mutations and selected with gefitinib, afatinib, or osimertinib. Mutations of emerging resistant cells were assessed.
Results
The resistance of T790M and C797S to gefitinib and osimertinib, respectively, was prevalent in the mutagenesis screening with the Ba/F3 cells harboring activating-mutation alone. From C797S/activating-mutation expressing Ba/F3, the additional T790M was a major resistant mechanism in gefitinib and afatinib selection and the additional T854A and L792H were minor resistance mechanisms only in afatinib selection. However, the additional T854A or L792H mediated resistance to all classes of EGFR-TKI. Surprisingly, no resistant clone due to secondary mutation emerged from activating-mutation alone in the gefitinib + osimertinib selection.
Conclusions
We showed the resistance mechanism to EGFR-TKI focusing on first- and second-line osimertinib using ENU mutagenesis screening. Additional T854A and L792H on C797S/activating-mutation were found as afatinib resistance and not as gefitinib resistance. Thus, compared to afatinib, the first-generation EGFR-TKI might be preferable as second-line treatment to C797S/activating-mutation emerging after first-line osimertinib treatment.
EGFR mutation-positive lung cancer is a relevant oncogene-addicted malignancy, which occurs in 15% of Caucasian lung adenocarcinoma patients and 50% of Japanese patients.
The prognosis of advanced EGFR mutant lung cancer has markedly improved since the introduction of EGFR tyrosine kinase inhibitor (EGFR-TKI) into clinical settings, leading to its overall survival of 3 to 4 years.
Afatinib versus cisplatin-based chemotherapy for EGFR mutation-positive lung adenocarcinoma (LUX-Lung 3 and LUX-Lung 6): analysis of overall survival data from two randomised, phase 3 trials.
Updated overall survival results from a randomized phase III trial comparing gefitinib with carboplatin-paclitaxel for chemo-naive non–small cell lung cancer with sensitive EGFR gene mutations (NEJ002).
Final overall survival results of WJTOG 3405, a randomized phase 3 trial comparing gefitinib (G) with cisplatin plus docetaxel (CD) as the first-line treatment for patients with non–small cell lung cancer (NSCLC) harboring mutations of the epidermal growth factor receptor (EGFR).
However, almost all patients experience disease progression because of acquired resistance within a couple of years. The T790M mutation — the substitution of 790th threonine to methionine in the EGFR kinase protein — is a major resistance mechanism mediating the resistance to first- and second-generation EGFR-TKI — gefitinib, erlotinib and afatinib.
The third-generation EGFR-TKI, osimertinib, which selectively inhibits the T790M mutation by covalent binding to the C797 residue, has been approved for patients with confirmed T790M mutation in several countries, such as the United States and Japan.
In contrast, osimertinib in first-line treatment has recently shown superiority in the progression-free survival of EGFR-activating-mutation-positive patients when compared to first-generation EGFR-TKI by approximately a 9 months advantage (18.9 months vs. 10.2 months, respectively), indicating that osimertinib administration should be moved to first-line treatment.
The mechanisms of acquired resistance to first- and second-generation EGFR-TKIs in first-line treatment have been shown to comprise a secondary mutation, such as T790M in EGFR, bypass pathway activation mediated by MNNG HOS Transforming gene (MET) amplification, hepatic growth factor (HGF) – mediated Met activation or BRAF mutation, and other mechanisms, such as SCLC transformation.
Hepatocyte growth factor expression in EGFR mutant lung cancer with intrinsic and acquired resistance to tyrosine kinase inhibitors in a Japanese cohort.
High MET amplification level as a resistance mechanism to osimertinib (AZD9291) in a patient that symptomatically responded to crizotinib treatment post-osimertinib progression.
However, contrary to the dominancy of T790M in resistance to first- and second-generation EGFR-TKIs, resistance mechanisms against osimertinib have been shown to be more heterogeneous by Lin et al.
Yang Z, Yang N, Ou Q, et al. Investigating novel resistance mechanisms to third-generation EGFR tyrosine kinase inhibitor osimertinib in non–small cell lung cancer patients [e-pub ahead of print]. Clin Cancer Res. https://doi.org/10.1158/1078-0432.CCR-17-2310, accessed May 7, 2018.
analyzed plasma samples from patients who progressed on first-line osimertinib treatment and showed various resistance mechanisms including C797S, amplification of MET, MEK1 mutation, and KRAS mutation et cetera, suggesting that resistance mechanism to osimertinib is diverse. Considering the results of clinical studies mentioned above, treatments should be strategized based on the diversity in resistance mechanisms. In addition to these presented resistance mechanisms, several preclinical studies have indicated other important mechanisms, which should be potential treatment targets, such as wild-type EGFR amplification, upregulation of protein inhibitor of activated STAT1 (STAT) or C-terminal Src kinase (c-Src), activation of Src family tyrosine kinases (SFK)/focal adhesion kinase (FAK) signaling, Yes-associated protein (YAP) and STAT signaling, Akt activation and overexpression of receptor tyrosine kinase related to Src.
Amplification of EGFR wild-type alleles in non–small cell lung cancer cells confers acquired resistance to mutation-selective EGFR tyrosine kinase inhibitors.
T790M-selective EGFR-TKI combined with dasatinib as an optimal strategy for overcoming EGFR-TKI resistance in T790M-positive non–small cell lung cancer.
According to the aforementioned results, the combination therapy of EGFR with the corresponding pathway would play an important role. Based on this background, in this study, we focused on the resistance by EGFR kinase domain mutations. We performed N-ethyl-N-nitrosourea (ENU) mutagenesis screening to investigate the differences in the resistance mechanism between first- and second-generation EGFR-TKIs, and osimertinib administered as first-line or second-line of EGFR-TKI treatment. The major acquired resistance to first-line osimertinib was C797S and that to gefitinib was T790M. Our study indicated that to overcome C797S emerging in first-line osimertinib treatment, first-generation EGFR-TKI, rather than afatinib, is preferable. Furthermore, the combination of gefitinib and osimertinib might be a promising owing to the emergence of only few resistant clones in our study.
Materials and Methods
Reagent and Cell Culture
The Ba/F3 cells harboring EGFR mutations introduced following the procedure described below were cultured in low glucose Dulbecco’s minimal essential medium (DMEM) with 10% fetal bovine serum (FBS). The drugs used in the experiments were purchased from the companies as follows: afatinib, ChemieTek (Indianapolis, Indiana); brigatinib, Shanghai Biochem (Shanghai Shi, China); dacomitinib, Active Biochemicals (Hong Kong, China); gefitinib, LC laboratories (Woburn, Massachusetts); and osimertinib, Selleck (Houston, TX).
Generating Lentivirus and Stable Expressing Ba/F3 Cells
The Ba/F3 cells expressing EGFR-activating-mutation alone (del19, L858R) and together with T790M, C797S and C797S/T790M were generated as described previously.
The T854A mutants were introduced into pENTR (ThermoFisher; Waltham, Massachusetts) with activating-mutation alone or with C797S/activating-mutation by QuikChange site-directed mutagenesis using the following primers: T854A F–GCCCAAAATCTGCGATCTTGACATG and T854A R–CATGTCAAGATCGCAGATTTTGGGC.
The resulting pENTR-EGFR mutation constructs were sequenced and used as a template to construct the pLenti 6.3 lentiviral vector using LR clonase II. The lentivirus was prepared by transfecting the pLenti6.3 constructs along with helper plasmids (ViraPower, ThermoFisher) in 293FT cells. Virus production, collection, and infection were completed following the manufacturer’s protocol. Ba/F3 cells were selected by culturing for 1 week with 7 μg/mL blasticidin in DMEM with interleukin-3 (IL-3)–supplemented 10% FBS and then for 1 week in DMEM without IL-3 with 7 μg/mL blasticidin, and finally in DMEM without IL-3 and blasticidin to obtain the EGFR signaling-addicted cells.
ENU Mutagenesis Screening
Clonal Ba/F3 cells with del19, L858R, C797S/del19, and C797S/L858R were obtained using the limiting dilution method, and EGFR-TKI–sensitive clones expressing each type of mutation were selected by TKI exposure for 1 week. Then, 3 × 108 Ba/F3 cells were treated with 100 μg/mL of ENU for 24 hours, followed by washing with phosphate-buffered saline once to remove ENU, and cultured in DMEM 10%-supplemented FBS medium for 24 hours. Cells (5 × 107) were seeded into 96-well plates with 1 × 105 cell/well in each EGFR-TKI–containing medium containing gefitinib, 150, 300, 600 and 1200 nmol/L; osimertinib, 150, 300, 600 and 1200 nmol/L; gefitinib plus osimertinib, 150 + 150, 300 + 300 nmol/L for del19 or L858R; gefitinib, 150, 300, 600 and 1200 nmol/L; and afatinib, 75, 150, and 300 nmol/L for C797S/del19. For C797S/L858R-expressing Ba/F3 cells, 5 × 104 cells/well were seeded into 96-well plates and treated with 300, 600, and 1200 nmol/L gefitinib and 150 and 300 nmol/L afatinib. The plates were observed twice or thrice a week until 4 weeks after initiating TKI exposure. Resistant cells detected as visible colonies were selected and evaluated for their sequence of the EGFR tyrosine kinase domain.
Cell Viability Assay
Three-day cell viability assays were performed by seeding 2000 cells per well of Ba/F3 cells into black transparent-bottom 96-well plates. The cells were treated with each TKI across a 10-dose range from 0.3 nmol/L to 10 μmol/L on the same day. After 72 hours of drug treatment, cell viability was determined using the Cell-Titer Glo assay (Promega, Madison, Wisconsin).
Western Blotting
The cells grown under the specified conditions were lysed and boiled for 5 minutes at 100°C followed by vortexing. Western blot analyses were conducted after separation by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transfer to polyvinylidene difluoride membranes. After blocking in 5% bovine serum albumin with Tris-buffered saline/Tween 20 (TBS-T) or 4% milk/TBS-T, membranes were incubated with phospho-EGFR antibody, total EGFR, phospho-Akt, total Akt, phospho-ERK, total ERK1/2, phospho-S6, total S6, or β-actin.
Results
Comparison of Resistance Mechanism Emerging From First-Line EGFR-TKI
Before ENU mutagenesis screening, we selected the clonal Ba/F3 cells harboring EGFR-del19 or L858R that were highly sensitive to EGFR-TKIs as assessed by screening (Supplementary Figs. 1A and B). From ENU mutagenesis, the major resistance mechanism emerging from gefitinib screening was found to be +T790M mutation, followed by +wild-type (no additional mutation in EGFR), in del19 and L858R, regardless of gefitinib concentrations (Figs. 1A and 1B). In contrast, +C797S mutation was a major resistance mechanism that emerged from osimertinib screening — in more than 50% of del19 and approximately 40% of L858R (Figs. 1C and 1D). The C797S mutation emerging from higher concentrations of osimertinib, 600 or 1200 nmol/L, was few in number, whereas the T790M mutation from gefitinib was equally observed across the concentration. The cell viability assay using Ba/F3 cells expressing activating-mutation with C797S showed high resistance to osimertinib, high sensitivity to first-generation EGFR-TKI treatment, and intermediate sensitivity to second-generation EGFR-TKIs (afatinib and dacomitinib) treatment. Concentration that inhibits 50% (IC50) values of osimertinib, gefitinib, and afatinib to Ba/F3 expressing C797S/del19 were 348.9 nmol/L, 2.9 nmol/L, and 2.3 nmol/L, respectively (Supplementary Figs. 1C and 1D). The same assay using Ba/F3 cells expressing activating-mutation with T790M showed clear sensitivity to osimertinib, obvious resistance to first-generation treatment, and intermediate sensitivity to second-generation treatment. IC50 values of osimertinib, gefitinib, and afatinib to Ba/F3 expressing T790M/del19 were 4.3 nmol/L, 4238 nmol/L, and 73.9 nmol/L, respectively (Supplementary Figs. 2A and 2B).
Figure 1The pattern of resistance mutations to initial gefitinib or osimertinib treatment from N-ethyl-N-nitrosourea (ENU) mutagenesis. (A–D) T790M mutation was found in resistant clones developed from gefitinib-treated Ba/F3 cells expressing EGFR-del19 (A) and EGFR-L858R (B) after ENU mutagenesis, while the C797S mutation was found from osimertinib-treated Ba/F3 cells, EGFR-del19 (C), and EGFR-L858R (D). (E) The actual numbers of resistant clones observed in each screening are shown. Gef + Osim, gefitinib + osimertinib; add. Muts: additional mutations.
These results indicated that because the activating-mutation with T790M is a relevant cause for resistance against first- and second-generation EGFR-TKI, the activating-mutation with C797S should become resistant to third-generation EGFR-TKI and be overcome by first-generation treatment. Some case reports have revealed that patients refractory to osimertinib by T790M loss with exchange to C797S emergence achieve clinical benefits by gefitinib administration.
The combination of gefitinib and osimertinib introduced no additional mutation showing resistance in our ENU mutagenesis (Fig. 1E). The number of resistant clones was much less in the combination treatment than in a single-agent screening, suggesting that this combination could be a promising first-line treatment option in the future.
T854A Mutation Mediates Afatinib Resistance From C797S/Activating-Mutation
We performed another ENU mutagenesis screening using Ba/F3 cells expressing activating-mutation with C797S mutation based on the result that C797S emerges after first-line osimertinib treatment. The additional T790M (located in cis) mutation was a major mechanism in activating-mutation with C797S to gefitinib (Figs. 2A and 2B). The T854A mutation (located in cis), which has already been reported as a minor resistant mutation to gefitinib or erlotinib, was found in 10% of afatinib screenings, whereas 40% to 60% of refractory clones have +T790M, resulting in multi-TKI-resistant triple mutants, which can be overcome by brigatinib and anti-EGFR antibody as described previously (Figs. 2C,2D, and 3A) (Supplementary Figs. 2C,2D, and 3A).
Acquired resistance to epidermal growth factor receptor kinase inhibitors associated with a novel T854A mutation in a patient with EGFR-mutant lung adenocarcinoma.
The obtained clones with T854A/C797S/activating-mutation showed intermediate resistance to first- and second-generation TKIs and significant sensitivity to brigatinib (95.1 nmol/L, 72.5 nmol/L, and 27.1 nmol/L of IC50 to Ba/F3 cells with T854A/C797S/activating-mutation by gefitinib, afatinib, and brigatinib, respectively) (Figs. 2E, 2F, and 3A). Western blotting confirmed that brigatinib inhibited EGFR phosphorylation and downstream signal pathway. Although afatinib inhibited T854A/C797S/activating-mutation at a similar concentrations to brigatinib, the reported plasma concentration of afatinib is approximately 50 nmol/L to 60 nmol/L, suggesting that 100 nmol/L of afatinib cannot be usually achieved in a clinical setting, whereas the maximum concentration of brigatinib in the human body was reported as 2485.9 nmol/L (Supplementary Figs. 3B and 3C).
Figure 2The T854A/C797S mutation as afatinib resistant mechanism was found after ENU mutagenesis. (A–D) The additive T790M mutation leading to the triple mutant; C797S/T790M/activating-mutation was found in resistant clones developed from gefitinib-treated Ba/F3 cells expressing EGFR-C797S/del19 (A) and EGFR-C797S/L858R (B) after N-ethyl-N-nitrosourea (ENU) mutagenesis, while the third mutation, T854A or L792H, other than T790M, was found from afatinib-treated corresponding Ba/F3 cells, EGFR-C797S/del19 (C) and EGFR-C797S/L858R (D). (E–G) Afatinib resistance obtained from ENU mutagenesis of C797S/activating-mutation-expressing Ba/F3 cells, EGFR-C797S/del19+T854A (E), EGFR-C797S/L858R+T854A (F), and EGFR-C797S/L858R+L792H (G) were treated with indicated drugs for 72 hours and assessed using the CellTiter-Glo assay (Promega, Madison, Wisconsin).
Only one clone, L792H mutation (located in cis) was also obtained from afatinib selection of C797S/L858R screening (Fig. 2D). This mutation has not been reported as being associated with afatinib resistance; however, it has been reported as an osimertinib resistance by Chen et al.
The cell viability assay and Western blotting showed that this novel mutation, L792H/C797S/L858R, mediates resistance not only to afatinib and osimertinib but also to brigatinib. This is contrary to T854A/C797S mutation. Gefitinib presented moderate efficacy compared to other inhibitors with 101.3 nmol/L of IC50 value in cell viability assay and inhibition of downstream phosphorylation at 100 nmol/L in Western blotting (Figs. 2G and 3A) (Supplementary Fig. 3D).
To further confirm the resistance of T854A, we generated Ba/F3 cells expressing T854A/activating-mutation and T854A/C797S/activating-mutation. The T854A/activating-mutation showed a maintained sensitivity to afatinib and osimertinib, moderate resistance to gefitinib with IC50 of 50 nmol/L to 60 nmol/L, and intermediate sensitivity to brigatinib in cell viability assays (Fig. 3B) (Supplementary Figs. 4A and 4B). The inhibition of EGFR phosphorylation and downstream pathway with indicated TKIs assessed by Western blotting corresponded with cell viability assay results (Supplementary Figs. 4C and 4D). In a clinical setting, T854A/activating-mutation might not be a major problematic issue due to the susceptibility to afatinib or osimertinib. The T854A/C797S/activating-mutation was highly refractory to osimertinib and moderately resistant to gefitinib, afatinib, and brigatinib with an IC50 value of approximately 50 nmol/L as assessed by cell viability assay. The T854A/C797S/activating-mutation of L858R was less sensitive than that of del19 (Figs. 3B, 4A, and 4B). The inhibition of EGFR phosphorylation and downstream signaling evaluated by Western blotting of T854A/C797S/activating-mutation expressing Ba/F3 cells treated with indicated drugs corresponded to cell viability assay results indicating that brigatinib is a more potent inhibitor against T854A/C797S/activating-mutation than clinically available EGFR-TKIs (Figs. 4C and 4D).
Figure 3The concentration that inhibits 50% (IC50) values for the mutant EGFR-expressing Ba/F3 cells. (A) IC50 values for the Ba/F3-EGFR-mutant cells obtained by N-ethyl-N-nitrosourea (ENU) mutagenesis. Each Ba/F3 cell line harboring the indicated gefitinib or afatinib resistant triple mutation was treated with the indicated EGFR-TKIs. (B) IC50 values for the Ba/F3 cells introduced the indicated EGFR mutations (T854A/activating-mutation with or without C797S). The indicated Ba/F3 cells were treated with the indicated EGFR-TKIs.
Figure 4The T854A mutation shows resistance to first- and second-generation EGFR-TKIs and sensitivity to brigatinib. (A,B) The Ba/F3 cells that were introduced T854A in addition to EGFR-C797S/del19 (A) and EGFR-C797S/L858R (B) were treated with indicated drugs for 72 hours, and cell viability was assessed using the CellTiter-Glo assay (Promega). (C,D) The Ba/F3 cells expressing EGFR-T854A/C797S/del19 (C) and EGFR-T854A/C797S/L858R (D) were treated with gefitinib, afatinib, osimertinib, and brigatinib for 6 hours at indicated concentrations. EGFR phosphorylation and downstream signal pathway were evaluated by Western blotting. (E) The schematic model of the emergence of resistance mutations to EGFR-TKIs is noted according to drug sequence.
On the basis of our findings, we propose the predicted treatment flow after the approval of first-line osimertinib as in Figure 4E. Currently, the initial treatment choice for patients with EGFR activating-mutation is first- and second-generation EGFR-TKIs — gefitinib, erlotinib, or afatinib — which inevitably lose efficacy mainly because of the emergence of T790M mutation within approximately 1 year. After the approval of first-line osimertinib, osimertinib would be the first choice as an initial treatment and C797S might be a major acquired resistance mechanism mediated by secondary mutation to osimertinib based on our ENU mutagenesis screening results and a previous report by Ercan et al.
The C797S/activating-mutation observed in osimertinib administration can be overcome by first- and second-generation EGFR-TKI. Our mutagenesis screening indicated that the application of afatinib to the C797S/activating-mutation induced three types of resistant mutations including the T854A/C797S mutation, the L792H/C797S mutation, in addition to the major C797S/T790M mutation. In contrast, only C797S/T790M emerged as a resistant clone from gefitinib screening. C797S/T790M has been known clinically as an osimertinib resistance mechanism emerging from the T790M/activating-mutation and has been observed in our ENU mutagenesis screening (Supplementary Fig. 5). The emergence of diverse resistant mechanisms possibly result in difficult or complex treatment strategies, suggesting that first-generation EGFR-TKI therapy would be more preferablein second-line to C797S/activating-mutation than second-generation would be. The C797S mutation interrupts the covalent binding of afatinib to EGFR, as observed in osimertinib, leading to the IC50 value for C797S/activating-mutation getting close to the achievable plasma concentration of afatinib (48 nmol/L to 62 nmol/L), which is different from gefitinib, whose IC50 value was almost constant regardless of presence of C797S; this may contribute to the diversity seen in afatinib selection.
Discussion
We performed ENU mutagenesis screening to evaluate gefitinib, afatinib, or osimertinib for activating-mutation alone and gefitinib or afatinib for C797S/activating-mutation to predict the preferable treatment strategy after osimertinib is approved to be a first-line treatment option. C797S/activating-mutation as resistance to osimertinib, C797S/T790M/activating-mutation as common resistance to gefitinib, and afatinib and T854A/C797S/activating-mutation as resistance to the lower concentration of afatinib were observed in mutagenesis screening with EGFR-activating-mutation alone and C797S/activating-mutation-harboring cells. L792H/C797S/L858R was also obtained from afatinib selection of C797S/L858R, although only one clone emerged. Reportedly, compound mutation defined as double or triple mutation in the EGFR kinase domain is related to EGFR-TKI resistance and poor clinical outcome.
In our study, we observed that mutation accumulation emerged during EGFR-TKI treatment regardless of the sequence and finally resulted in compound, triple mutation mediating highly multiple EGFR-TKI resistance. Components of a triple mutant might be dependent on the original mutation and drug types and concentration as shown by Kobayashi et al.
with similar method. In the current study, T854/C797S-triple mutant was observed from lower concentrations of afatinib in both C797S/del19 and C797S/L858R screening, and L792H/C797S-triple was only observed from the lower concentration of afatinib in C97S/L858R, whereas C797S/T790M-triple was observed irrespective of the original mutant, drug types, and concentrations. The combination of brigatinib with anti-EGFR antibody, as we previously reported, is important because of its efficacy against C797S/T790M-triple mutants.
Gefitinib plus osimertinib resulted in a fewer number of resistant clones, suggesting a promising, new first-line treatment for EGFR-mutant lung cancer in future. The improved efficacy of the combination might be because of its two independent mechanisms; one is a collaborative action in which gefitinib inhibits the emergence of T790M and osimertinib inhibits that of C797S, another is the inhibition of EGFR wild-type. Nukaga et al.
Amplification of EGFR wild-type alleles in non–small cell lung cancer cells confers acquired resistance to mutation-selective EGFR tyrosine kinase inhibitors.
indicated that amplification of EGFR wild-type alleles but not mutant alleles was sufficient to confer acquired resistance; the combination of third-generation EGFR-TKI with afatinib or cetuximab restored the sensitivity, suggesting that concurrent use of gefitinib worked similarly.
There are several limitations to our study. First, the resistant mutation found in our study might not to be representative of clinical findings because ENU mutagenesis can artificially introduce base substitutions (T>A, C>T, T>C, T>G, C>A, C>G) with a different frequency to each other and with variable patterns between each experiment.
And this mutagenesis screening is specifically designed to detect the mutations in EGFR kinase domain. Ba/F3 cells used in this study are not suitable to evaluate a bypass pathway, such as MET, because they are originally mouse pro-B cells. Moreover, mutation introduced by ENU spreads widely across the genes, making it difficult to elucidate the importance of every mutation. According to the reports suggesting the heterogeneous resistance mechanism to osimertinib, it might be difficult to simulate all mechanisms by single method. Therefore, we focused on EGFR kinase domain mutation in this study. In fact, our ENU screening result is expected to be reasonable in view of kinase domain mutation indicating that the major clone of resistance in the ENU screening of gefitinib or afatinib in activating-mutation was T790M and that of evaluating osimertinib in T790M/del19 was C797S/T790M, which seems to reliably represent the clinical phenomenon. Second, C797S mutation would not always constitute a major resistance mechanism to osimertinib, unlike T790M which is a dominant resistance mechanism in first-line gefitinib, erlotinib, or afatinib treatment. In fact, osimertinib resistance mechanisms have been recently reported as more diverse than expected.
Yang Z, Yang N, Ou Q, et al. Investigating novel resistance mechanisms to third-generation EGFR tyrosine kinase inhibitor osimertinib in non–small cell lung cancer patients [e-pub ahead of print]. Clin Cancer Res. https://doi.org/10.1158/1078-0432.CCR-17-2310, accessed May 7, 2018.
This data might indicate a disadvantage to the importance of our result, but patients in whom disease progressed by C797S mutation exist, and we expect that the detection of C797S using new modalities, such as liquid biopsy, will be more important so as not to miss precisely administering first-generation EGFR-TKI against C797S. Third, the superiority of first-line osimertinib to standard EGFR-TKI has not been confirmed from a viewpoint of EGFR-TKI sequential treatments to achieve the longer duration of clinical response by TKIs, which might contribute to better survival. As Park et al. has reported at the 2017 World Conference on Lung Cancer, the median treatment duration of osimertinib is long (31.5 months) among patients receiving sequential first-line afatinib–second-line osimertinib treatment.
Although we should continue investigating the best sequential EGFR-TKI treatment to find the best therapy for EGFR mutant lung cancer, first-line osimertinib may be a promising choice at this time based on the FLAURA trial results.
In conclusion, we elucidated the resistant mechanism of EGFR-TKI, focusing on not only the present standard treatment but also the coming paradigm change of first-line osimertinib using ENU mutagenesis screening. The additional T854A and L792H on C797S/activating-mutation were newly found as an afatinib-resistance mechanism, indicating that re-biopsy will remain important for the treatment of patients with EGFR mutation. A number of resistant mutations (T790M, T854A, and L792H) found in afatinib resistance may require development of individual treatment for each mutation pattern, implying that first-generation EGFR-TKI is preferable for second-line treatment for the C797S/activating-mutation that emerged from first-line osimertinib because fewer mutation patterns found in first generation (only T790M in our screening) were expected to be targetable by brigatinib with anti-EGFR antibody. Considering that front-line treatment for EGFR activating-mutation has been changing, we must continue to explore better strategy in addition to first-line osimertinib. Combination of gefitinib and osimertinib might be a first choice because less resistance was found in our screening, suggesting that a longer duration of efficacy would be achieved compared to single-agent use based on the mutual inhibition of each major secondary mutation (T790M and C797S).
Acknowledgments
This work was supported by grants from the JSPS KAKENHI grant number JP16H04715 (to R.K.), and JP15H02368 and JP17H06327 (to N.F.), and the grant from the AMED grant numbers 17cm0106203h0002 and 17ck0106231h0002 (to R.K.), and the grant from The Vehicle Racing Commemorative Foundation (to R.K.), and the Grant for Lung Cancer Research that is founded by the Japan Lung Cancer Society (to K.U.). The authors thank all laboratory members, especially Dr. A. Takemoto, Ms. S Koike, and Ms. T. Oh-hara at the Japanese Foundation for Cancer Research (JFCR) for fruitful discussions and technical advice for the in vitro experiments.
Afatinib versus cisplatin-based chemotherapy for EGFR mutation-positive lung adenocarcinoma (LUX-Lung 3 and LUX-Lung 6): analysis of overall survival data from two randomised, phase 3 trials.
Updated overall survival results from a randomized phase III trial comparing gefitinib with carboplatin-paclitaxel for chemo-naive non–small cell lung cancer with sensitive EGFR gene mutations (NEJ002).
Final overall survival results of WJTOG 3405, a randomized phase 3 trial comparing gefitinib (G) with cisplatin plus docetaxel (CD) as the first-line treatment for patients with non–small cell lung cancer (NSCLC) harboring mutations of the epidermal growth factor receptor (EGFR).
Hepatocyte growth factor expression in EGFR mutant lung cancer with intrinsic and acquired resistance to tyrosine kinase inhibitors in a Japanese cohort.
High MET amplification level as a resistance mechanism to osimertinib (AZD9291) in a patient that symptomatically responded to crizotinib treatment post-osimertinib progression.
Yang Z, Yang N, Ou Q, et al. Investigating novel resistance mechanisms to third-generation EGFR tyrosine kinase inhibitor osimertinib in non–small cell lung cancer patients [e-pub ahead of print]. Clin Cancer Res. https://doi.org/10.1158/1078-0432.CCR-17-2310, accessed May 7, 2018.
Amplification of EGFR wild-type alleles in non–small cell lung cancer cells confers acquired resistance to mutation-selective EGFR tyrosine kinase inhibitors.
T790M-selective EGFR-TKI combined with dasatinib as an optimal strategy for overcoming EGFR-TKI resistance in T790M-positive non–small cell lung cancer.
Acquired resistance to epidermal growth factor receptor kinase inhibitors associated with a novel T854A mutation in a patient with EGFR-mutant lung adenocarcinoma.
Disclosure: Dr. Uchibori has received grants from the Japan Lung Cancer Society. Dr. Inase has received scholarship donations from Chugai Pharmaceutical, Ono Pharmaceutical, Taiho Pharmaceutical, Kyorin Pharmaceutical, Astellas, and Eli Lilly Japan. Dr. Nishio has received speaker fees from Ono Pharmaceutical, Bristol-Myers Squibb Japan, Pfizer, Chugai Pharmaceutical, Eli Lilly, Taiho Pharmaceutical, AstraZeneca, Boehringer Ingelheim, MSD, Novartis; and research funding from Novartis, Ono Pharmaceutical, Chugai Pharmaceutical, Bristol-Myers Squibb Japan, TAIHO Pharmaceutical, Eli Lilly, Pfizer, Astellas, MSD, and Astra Zeneca. Dr. Fujita has received grants from the Ministry of Education, Culture, Sports, Science, and Technology, Japan, and the Japan Society for the Promotion of Science; and has received research funding from Daiichi-Sankyo, Api, Toppan Printing, and Taiho Pharmaceutical. Dr. Katayama has received grants from the Japan Society for the Promotion of Science, the Japan Agency for Medical Research and Development, and The Vehicle Racing Commemorative Foundation; and has received research funding from TAIHO Pharmaceutical, Fujifilm, and Toppan Printing.
Cancers exhibit enormous intratumoral genomic diversities and ever-changing clonal variation, even if the clones have initially originated from the same key oncogenic mutations, such as EGFR, KRAS, or BRAF mutations. The clonal dynamics offer great survival advantages to cancer cells during molecularly targeted therapy, with enrichment of resistance properties under selective pressure in surviving clones. The development of EGFR tyrosine kinase inhibitors (EGFR TKIs) has been a major breakthrough for the treatment of NSCLC; however, widespread emergence of drug resistance has also called for rigorous investigations of the underlying resistance mechanisms.
30511-2&id=gr1.jpg){kind=link}
30511-2&id=gr2.jpg){kind=link}
30511-2&id=gr3.jpg){kind=link}
30511-2&id=gr4.jpg){kind=link}